Laporan Praktik Biomol
Ini pa Laporan Praktik Biologi sel Molekuler
Molecular cloning and sequence analysis of a cDNA encording pituitary thyroid stimulating hormone β-subunit of the Chinese soft-shell turtle Pelodiscus sinensis and regulation of its gene expression
General and Comparative Endocrinology 146 (2006) 74–82
www.elsevier.com/locate/ygcen
0016-6480/$ – see front matter © 2005 Elsevier Inc. All rights reserved.
doi:10.1016/j.ygcen.2005.09.021
Molecular cloning and sequence analysis of a cDNA encoding pituitary thyroid stimulating hormone -subunit of the Chinese soft-shell turtle Pelodiscus sinensis and regulation of its gene expression
Jung-Tsun Chien a,b, Indrajit Chowdhury a, Yao-Sung Lin b, Ching-Fong Liao a, San-Tai Shen a, John Yuh-Lin Yu a,¤
a Endocrinology Laboratory, Institute of Cellular and Organismic Biology, Academia Sinica, Taipei 115, Taiwan, ROC
b Institute of Ecology and Evolutionary Biology, College of Life Science, National Taiwan University, Taipei 106, Taiwan, ROC
Received 17 July 2005; revised 14 September 2005; accepted 17 September 2005
Available online 15 November 2005
Abstract
A cDNA encoding thyroid stimulating hormone -subunit (TSH) was cloned from pituitary of the Chinese soft-shell turtle, Pelodiscus sinensis, and its regulation of mRNA expression was investigated for the Wrst time in reptile. The Chinese soft-shell turtle TSH cDNA was cloned from pituitary RNA by reverse transcription and polymerase chain reaction (RT-PCR), and rapid ampliWcation cDNA end (RACE) methods. The Chinese soft-shell turtle TSH cDNA consists of 580-bp nucleotides, including 67-bp nucleotides of 5-untranslated region (UTR), 402-bp of the open reading frame, and 97-bp of 3-UTR followed by a 14 poly (A) trait. It encodes a precursor protein molecule of 133 amino acids with a putative signal peptide of 19 amino acids and a putative mature protein of 114 amino acids. The number and position of 12 cysteine residues, presumably forming six disulWde bonds, one putative asparagine-linked glycosylation site, and six proline residues that are found at positions for changing the backbone direction of the protein have been conserved in the turtle as in other vertebrate groups. The deduced amino acid sequence of the Chinese soft-shell turtle TSH mature protein shares identities of 82–83% with birds, 71–72% with mammals, 49–57% with amphibians, and 44–61% with Wsh. The Chinese soft-shell turtle pituitaries were incubated in vitro with synthetic TRH (TSH-releasing hormone), thyroxine and triiodothyronine at doses of 10¡10 and 10¡8 M. TRH stimulated, while thyroid hormones suppressed, TSH mRNA levels in dose-related manner. The sequences of cDNA and its deduced peptide of TSH as well as the regulation of its mRNA level were reported for the Wrst time in reptile.
© 2005 Elsevier Inc. All rights reserved.
Keywords: Chinese soft-shell turtle; Pituitary; Thyrotropin (TSH) subunit; cDNA; Amino acid sequence; mRNA; TRH; Thyroid hormone
1. Introduction
All vertebrate species are characterized by possession of a pituitary gland, which secretes glycoprotein hormones–thyrotropin (TSH) and gonadotropins, that are synthesized, respectively, by thyrotrope and gonadotrope. All these pituitary glycoprotein hormones are composed of two structurally dissimilar subunits, and ; -subunits are identical in a species, while -subunits are speciWc and determine the hormonal activity and species speciWcity (Pierce and Parsons, 1981). The subunits are synthesized as separate protein from diVerent messenger RNAs expressed by diVerent genes, and following glycosylation they are associated by non-covalent bond to form biologically active hormonal molecules. The cDNAs and deduced amino acid sequences of TSHs have been demonstrated for species representative of diVerent animal groups for investigating phylogenetic diversity and evolution in vertebrates.
The primary structure of TSH protein has been known at least in nine species in mammals (Carr et al., 1987; Guidon et al., 1988; Gurr et al., 1983; Hirai et al., 1989; Maurer et al., 1984; Wondisford et al., 1998), four * Corresponding author. Fax: +886 2 2785 8059. E-mail address: johnylyu@gate.sinica.edu.tw (J.Y.-L. Yu). J.-T. Chien et al. / General and Comparative Endocrinology 146 (2006) 74–82 75 species in birds (Gregory and Porter, 1997; Hsieh et al., 2000; Kato et al., 1997, 1998), three species in amphibians (Buckbinder and Brown, 1993; Komoike and Ishii, 2003; Okada et al., 2000) and 11 species in Wsh (Chatterjee et al., 2001; Han et al., 2004; Herzog et al., 2003; Ito et al., 1993; Martin et al., 1999; Pradet-Balade et al., 1998; Quérat et al., 2000, 2004; Salmon et al., 1993; Sohn et al., 1999). Phylogenetic comparison reveals that the protein sequence of TSH is rather diversiWed among diVerent vertebrate groups. However, in reptiles the information on TSH subunit primary structure is completely lacking. Reptiles occupy a key position in evolutionary history of the vertebrates as the birds and mammals evolved from them. As the Chinese soft-shell turtle, Pelodiscus sinensis, is commercially cultured and easily accessible in Taiwan, we therefore cloned the pituitary TSH cDNA of the Chinese soft-shell turtle, for investigating the diversity of cDNA nucleotide and deduced protein sequence of TSH in a reptilian species for comparison with those of other vertebrate classes. Such information is important for understanding the phylogenetic diversity and evolution of pituitary TSH molecules in vertebrates. TSH regulates the growth and function of thyroid for formation of thyroid hormones, which are involved in regulation of growth, development, metabolism, and reproduction (Gorbman et al., 1983). In mammals, the formation and secretion of TSH are controlled by hypothalamic TSH releasing hormone (TRH) and thyroidal hormones, thus constituting the hypothalamus–pituitary–thyroid axis. It has been well known that TRH stimulates, while thyroid hormones suppress, the transcript level of TSH mRNA in mammals (Carr et al., 1985; Croyle and Maurer, 1984; Weintraub et al., 1989). Very little information has been available regarding the regulation of pituitary TSH in reptile (Preece and Licht, 1987; Sawin et al., 1981). In this study, we also investigated the regulation of TSH mRNA expression of the Chinese soft-shell turtle pituitary in vitro by synthetic mammalian TRH and thyroid hormones.
2. Materials and methods
2.1. Animal
Adult Chinese soft-shell mud turtles, P. sinensis (body weight of 700–1000 g), purchased from a local commercial breeder, were used for this study. All experimental procedures in handling of animals were reviewed and approved by the Laboratory Animal Ethics Committee, Academia Sinica.
2.2. Oligonucleotide design
Oligonucleotide primers for the ampliWcation of the Chinese soft-shell turtle TSH cDNA were designed based on the conserved region of chicken (Gregory and Porter, 1997), duck (Hsieh et al., 2000), and rat TSH (Croyle and Maurer, 1984). They were synthesized with ABI 394 DNA/RNA Synthesizer (Applied Biosystem, Foster city, CA, USA) by Quality Systems, Taipei, Taiwan. The sense primer and antisense primer were P5-1, 5-ATG AGT CCC ATC TTT CTG-3 and P3-1, 5-TAG GGC TTC TGT GGT TTA-3, respectively. The primers used for ampliWcation of the 5 ends of the Chinese soft-shell turtle TSH cDNA were: P5-2, 5-CAT GGT GTA CAG AAC AGT GGT AC-3 and P3-2, 5-GTA CCA CTG TTC TGT ACA CCA TG-3. The -actin primers: 5-GGT ATT GTG CTG GAC TCT GGT-3 and 5-TTT GGC CAG CCC CAT GGA TGT-3 were designed based on the Chinese
soft-shell turtle -actin subcloned sequence (J.T. Chien and J.Y.L. Yu, unpublished data, Endocrinology Laboratory, Institute of Cellular and Organismic Biology, Academia Sinica, Taipei). 2.3. RNA isolation and reverse transcription-polymerase chain reaction A total of three experiments was performed for RNA isolation and reverse transcription-polymerase chain reaction RT-PCR analysis to avoid possible errors derived from RT-PCR. Three turtles were used in each experiment. The turtles were sacriWced, pituitary glands were removed and placed into liquid nitrogen. Total pituitary cellular RNA was extracted with total RNA miniprep system kit (Viogene, Sunnyvale, CA, USA). The quality of RNA was measured at A260nm/A280nm. Only RNAs with A260 nm/A280 nm ratios of 1.6 to 2.0 were used for RT-PCR. Reverse transcription was performed using Moloney-murine leukemia virus (MMLV) reverse transcriptase (Stratagene, La Jolla, CA, USA), according to the procedure supplied by the
manufacturer. Oligod(T)17 primer (100 ng) and total cellular
RNA (500 ng) from pituitary glands were heated to
65 °C for 5min. Then, 10U of MMLV-RT was added to
each reaction and the reactions were incubated for 60min
at 37 °C. The PCRs were performed under hot-start condition
(94 °C, 2min) with pfu Turbo DNA polymerase (Stratagene,
La Jolla, CA, USA) for 35 cycles at 94 °C of 0.5min,
and at 52 °C, and 72 °C (1min each), and then 7min at
72 °C before holding at 4 °C.
2.4. 3- and 5-rapid ampliWcation of cDNA end (3-, 5-
RACE)
RACE technique was used to obtain the full length of the
Chinese soft-shell turtle TSH mRNA sequence including
the 3- and 5-UTR in accordance to the procedures provided
by the manufacturer (Life Technologies, Gaithersburg,
MD, USA). For 3-RACE, 1g of pituitary RNA was
primed with 3 adapter primer (3-AP: 5-GGC CAC GCG
TCG ACT AGT AC(T)17-3) and reverse transcribed using
MMLV-RT (SuperScript II reverse transcriptase, Life Technologies,
Gaithersburg, MD, USA) as described above. One
microliter of RT product was then ampliWed by PCR with
nest forward primer (P5-2: 5-CAT GGT GTA CAG AAC
AGT GGT AC-3) of the obtained sequence of the Chinese
76 J.-T. Chien et al. / General and Comparative Endocrinology 146 (2006) 74–82
soft-shell turtle TSH and abridge universal ampliWcation
primer (AUAP). For 5-RACE, the Wrst-strand cDNA was
synthesized from 1g of pituitary RNA using the obtained
cDNA sequence (primer 3-2: 5-GTA CCA CTG TTC TGT
ACA CCA TG-3) of TSH with MMLV-RT. The original
mRNA template was then removed by treatment with
RNase H, and the cDNA was puriWed by spin cartridge. A
homopolymeric tail of dCTP was added to the 3-end of the
Wrst-strand DNA by terminal deoxynucleotide transferase.
PCR ampliWcation was accomplished with 5 ampliWed
anchor primer (5-AAP: 5-GGC CAC GCG TCG ACT
AGT ACG GGI IGG GII GGG IIG-3) and a nest sequence
primer (P3-3: 5-TCT TAC CAT TGC TGT CCC GTG
TC-3). The PCR protocols for 3-end were performed under
hot-start condition (94 °C, 2min) with Taq DNA polymerase
(Life Technologies, Gaithersburg, MD, USA) for 35 cycles at
94 °C for 0.5min, and at 52 and 72°C (1min each), and then
7min at 72°C before holding at 4 °C; and 5-end were performed
under hot-start condition (94 °C, 2min) with Taq
DNA polymerase (Life Technologies) for 35 cycles of 94 °C
0.5min, 50, and 72 °C (1min each), and then 7min at 72 °C
before holding at 4 °C.
2.5. Nucleotide and amino acid sequence analysis
Nucleotide sequences of the cloned cDNAs or direct PCR
cDNA products were commercially determined by Xuorescence
dye termination reaction (BigDye Terminator Cycle
Fig. 1. The nucleotide sequence of the Chinese soft-shell turtle TSH cDNA includes 67 bp of 5 untranslated region, 402 bp of coding region, and 97 bp of 3
untranslated region followed by a 14 bp poly(A)+ tract. The predicted open reading frame encodes a precursor protein of 133 amino acid with a signal peptide
(SP) of 19 amino acids and a mature protein of 114 amino acids as shown under the nucleotide sequence. The putative polyadenylation signal (AATAAA) is
underlined. The start codon (ATG) and stop codon (TGA) are shown as boxed and shaded. The nucleotide sequence of the Chinese soft-shell turtle TSH
cDNA obtained from the present study appeared in GenBank under the Accession No. AY618874. The signal peptide is shown by underline.
-67 -58 +1 +354 +455 bp
-19 1 +114 aa
-67
cagcctctccaactcctcaatgcagactcaggctcctgtattgagggaagattcagctgccaacagc
-19 -1 1
ATG AGT CCC ATC TTT CTG ATG TCC CTT TTC TTT GGC CTG GCT TTT GGG CAT GCA ATG TCT 03
M S P I F L M S L F F G L A F G H A M S 01
TTT TGT GCT CCC ATT GAA TAT CTC ATC CAC GTG GAG AAG AGA GAA TGC GCC TAC TGC CTG 63
F C A P I E Y L I H V E K R E C A Y C L 21
GCC ATC AAC ACC ACC ATC TGT GCT GGA TTC TGC ATG ACA CGG GAC AGC AAT GGT AAG AAA 123
A I N T T I C A G F C M T R D S N G K K 41
CTG CTC CTC AAA AGT GCC CTC TCC CAG GAT GTG TGC ACA TAT AAA GAC ATG GTG TAC 183
L L L K S A L S Q D V C T Y K D M V Y 60
AGA ACA GTG GTA CTC CCT GGC TGC CCA CGA CAC ACC ATT CCC TAC TCT TAT CCA GTG 243
R T V V L P G C P R H T I P Y S Y P V 79
GCG ATG AGC TGC AAG TGT GGT AAA TGC AAC ACT GAT TAT AGT GAC TGC ATT CAC GAC 303
A M S C K C G K C N T D Y S D C I H D 98
ACA GTC AGG ACA GAC TAT TGC ACT AAA CCA CAG AAG CCC TAT AAC GTA TGA 354
T V R T D Y C T K P Q K P Y N V stop 114
gcttcttaatgaacgaggtagaaacgtatcttcttccccacagctagctagtggctgtttataactgactctcaaataa
aactgtatttcacaactg poly(a)14
SP Mature Protein
J.-T. Chien et al. / General and Comparative Endocrinology 146 (2006) 74–82 77
Sequencing Ready Reaction Kit, Perkin-Elmer, Foster City,
CA, USA) and analyzed by automated DNA sequencer
(Perkin-Elmer, Foster City, CA, USA). Multiple protein
sequence alignment was performed using CLUSTAL W program
and PileUP program from Wisconsin package of GCG
program (Aiyar, 2000; Thompson et al., 1994, 2000). Blosum-
62-amino acid substitution matrix was used to calculate
the protein sequence homology (HenikoV and HenikoV,
1992) of selected TSHs as listed in the construction of a
phylogenetic tree of vertebrate TSH-subunits.
2.6. Tissue speciWcity of TSH gene expression
Two experiments were conducted with two turtles in
each experiment. For tissue speciWcity study of TSH gene
expression, total RNA was isolated, as described above,
from various tissues including brain, pituitary, hypothalamus,
thyroid, muscle, liver, heart, and testis. The same
amount of total RNAs (1g) of each tissue was reverse
transcribed to the Wrst-strand DNA, and then subjected to
PCR ampliWcation of the entire coding region of the Chinese
soft-shell turtle as described above.
2.7. Regulation of the Chinese soft-shell turtle TSH mRNA
expression
The eVects of TRH, thyroxine (T4), and triidothyronine
(T3) on TSH mRNA levels of the Chinese soft-shell turtle
pituitary were investigated under in vitro conditions.
TRH (pGlu-His-Pro-NH2), T4, and T3, used in this experiment
were purchased from Sigma–Aldrich, USA. Pituitaries
were removed from adult male Chinese soft-shell
turtles and washed immediately in 1£ Hank’s buVer
(Sigma–Aldrich, USA) twice, then placed in sterile serumfree
M199 medium plus antibiotic–antimycotic (Life
Technologies, Grand Island, NY, USA) on ice. Each pitu-
Fig. 2. Multiple sequence alignments of vertebrate TSH subunits. The deduced amino acid sequences of the Chinese (C.) soft-shell turtle TSH mature protein
are aligned with those of TSH subunits from selected vertebrate species. For convenience, all TSHs are numbered in accordance with the C. soft-shell
turtle TSH from the putative N-terminus. The references and GenBank accession numbers of the TSH subunits are indicated in Materials and methods.
Amino acids identical to those of the Chinese soft-shell turtle TSH are each indicated by dots. Hyphens have been inserted to show deletion of amino acids in
order to obtain maximum homology. Amino acids ¡19 through ¡1 (underlined) represent the putative signal peptide sequence of the protein. Twelve conserved
cysteine residues are designated as C in boxed and shaded letters. C1–C12 are the positions of the 12 conserved cysteine residues. denotes the putative
glycosylation site. The numericals at the right column are the total numbers of amino acids of TSH precursor proteins of the selected vertebrate species.
78 J.-T. Chien et al. / General and Comparative Endocrinology 146 (2006) 74–82
itary was sliced to four pieces and preincubated for 1 h
before incubating for 24 h at 28 °C with TRH, T4, and T3
at doses of 10¡10 and 10¡8 M under 95% O2–5% CO2, in
1.0ml M199 medium plus antibiotic–antimycotic. The
control groups were without hormonal treatment. The
eVects of incubation time on TSH mRNA levels of the
Chinese soft-shell turtle pituitaries, as aVected by TRH,
T4, and T3 at 10¡8M doses were preliminarily investigated
at time intervals of 3, 12, and 24 h. The results revealed
that in TRH treated groups, TSH mRNA levels at 3 h of
incubation were approximately 20% lower than those at
12 and 24 h; while in T4 and T3 treated groups, TSH
mRNA levels at 3 h of incubation were about 30% higher
than those of 12 and 24 h. The TSH mRNA levels at 12
and 24 h of incubations were similar. For convenience, the
incubation time of 24 h was arbitrarily chosen for this
study. At the end of incubation, pituitaries were collected
for isolation of RNA. One microgram of RNA was
reverse transcribed as described above. The cDNA was
PCR ampliWed using TSH primers P5-1 and P3-1 by
real time quantitative PCR. As internal control in the real
time quantitative PCRs, -actin was also ampliWed simultaneously
for normalization (Han et al., 2004). Real time
quantitative PCR analysis was commercially performed
with 7000 Sequence Detection System (Applied Biosystem,
Foster City, CA, USA) by Blossom Biotechnologies,
Taipei, Taiwan to examine the relative mRNA levels of
TSH-subunit using Xuorescence dye SYBR Green 1 for
continuous observation of the ampliWed DNA level (Morrison
et al., 1998). Such assay allows rapid and accurate
quantiWcation of initial transcript copy number.
2.8. Construction of a phylogenetic tree of vertebrate TSH-
subunits
A phylogenetic tree of vertebrates TSH was analyzed
basing on the aligned amino acid sequences, and constructed
by neighbor-joining method (Molecular Evolutionary
Genetic Analysis, MEGA, Ver 2.1). For deriving
conWdence value of this analysis, bootstrap trials were replicated
1500 times. GenBank accession numbers or references
of TSH sequences analyzed in this study are as
follows: mouse (Gurr et al., 1983), bovine (Maurer et al.,
1984), rat (Carr et al., 1987), human (Guidon et al., 1988),
porcine (Hirai et al., 1989), horse (AAA96826), dog
(AAA97410), llama (U89294), gray short-tailed opossum
(AAL05938); quail (Kato et al., 1997), chicken (Gregory
and Porter, 1997), muscovy duck (Hsieh et al., 2000), Japanese
crested ibis (AB089501); Xenopus laevis (Buckbinder
and Brown, 1993), bullfrog (Okada et al., 2000), Japanese
toad (Komoike and Ishii, 2003); Siberian sturgeon (Quérat
et al., 2000); rainbow trout (Ito et al., 1993), European eel
(Pradet-Balade et al., 1998), goldWsh (Sohn et al., 1999),
salmon (Martin et al., 1999), bighead carp (Chatterjee et al.,
2001), zebraWsh (Herzog et al., 2003), Japanese eel (Han
et al., 2004), lungWsh (Quérat et al., 2004), grass carp
(AB003586), and common carp (BAA20082).
2.9. Statistical analysis
The data obtained from real time quantitative PCR
analysis of the regulation of TSH mRNA expression were
subjected to one way analysis of variance (one way
ANOVA). DiVerences between diVerent doses in diVerent
treated groups and the controls were tested by Newman–
Keuls’ test. DiVerences were signiWcant at P60.05.
3. Results
3.1. Cloning and sequence analysis of TSH cDNA from the
Chinese soft-shell turtle pituitary
A PCR product containing 403bp was obtained and
appeared as a single band in 2.5% agarose gel; this was identiWed
to encode the Chinese soft-shell turtle TSH-subunit
precursor molecule from its nucleotide sequence. To determine
the remaining 3 and 5 portions of the Chinese softshell
turtle TSH cDNA sequence, 5 and 3 rapid ampliWcation
of cDNA end (RACE) were performed. The cloned Chinese
soft-shell turtle TSH cDNA contained 580-bp
nucleotides, including 67-bp nucleotides of 5 untranslated
region (UTR), 402-bp of the open reading frame, and 97-bp
of 3 UTR followed by a 14-bp poly (A) tail (Fig. 1). The precursor
protein of the Chinese soft-shell turtle TSH subunit
consists of a putative signal peptide of 19 amino acids and a
putative mature protein of 114 amino acids (predicted by signalP
on-line program, http://www.cbs.dtu.dk/services/signalP).
The mature protein of the Chinese soft-shell turtle
TSH was compared with those of mammalian, avian,
amphibian, and Wsh species (Fig. 2). As indicated, 12 cysteine
residues of the Chinese soft-shell turtle TSH are conserved
at positions 3, 17, 20, 28, 32, 53, 68, 84, 86, 89, 96, and 108 of
aligned number. One asparagine-linked glycosylation site,
located between the 3rd cysteine and 4th cysteine, is conserved.
In addition, six proline residues are also conserved at
positions of 5, 66, 69, 74, 79, and 111 of the aligned number
as those found in mammals and birds, as well as in most
amphibians and Wsh.
3.2. Tissue speciWcity of TSH gene expression
TSH mRNA (appeared as a band of approximate 400bp)
was only expressed in pituitary, but not in brain, hypothala-
Fig. 3. The tissue speciWcity of the Chinese soft-shell turtle TSH mRNA
expression analyzed by RT-PCR. Total cellular RNAs of 1 g each from
brain (Br), hypothalamus (Hy), pituitary (Pi), thyroid (Ty), muscle (Mu),
liver (Lv), heart (Ht), and testis (Ts) were used. -Actin, which served as a
reference of the loading amount of total RNA for each tissue was also
included. PCR products of cDNA were revealed by 2.5% agarose gel electrophoresis.
J.-T. Chien et al. / General and Comparative Endocrinology 146 (2006) 74–82 79
mus, thyroid, muscle, liver, heart, and testis (Fig. 3). The nucleotide
sequence of TSH cDNA cloned from the pituitary is
identical to the TSH nucleotide sequence described as above.
3.3. Regulation of the Chinese soft-shell turtle TSH mRNA
expression
As shown in Fig. 4A, the TSH mRNA levels of the Chinese
soft-shell turtle pituitaries treated with doses of 10¡10
and 10¡8M of TRH, as analyzed by real-time quantitative
PCR, were 140 and 170%, respectively, in comparison to the
controls (100%). TSH mRNA levels of the Chinese softshell
turtle pituitaries treated with T4 at doses of 10¡10 and
10¡8M were 72 and 50%, respectively, in comparison to the
controls (100%) (Fig. 4B). TSH mRNA levels in T3-treated
groups at doses of 10¡10 and 10¡8M were 73 and 55%,
respectively, in comparison to the controls (100%) (Fig. 4C).
4. Discussion
In comparison to other vertebrate groups, one amino
acid residue was deleted in the Chinese soft-shell turtle
TSH at position between 7th cysteine and 8th cysteine.
The deduced amino acid sequence of the Chinese soft-shell
turtle TSH mature protein shares identities of 82–83%
with birds, 71–72% with mammals, 49–57% with amphibians,
and 44–61% with Wsh. When comparing with gonadotropins
of turtles, the Chinese soft-shell turtle TSH shares
33% homology with FSH of the same species (Chien et al.,
2005), 33–32% homologies, respectively, with FSH and
LH of Reeve’s turtle (Aizawa and Ishii, 2003). The present
study demonstrated that the number and position of 12 cysteine
residues, one asparagine-linked glycosylation site and
six proline residues have been conserved in TSH-subunit
of the Chinese soft-shell turtle as in other vertebrate groups
Fig. 4. Real time quantitative PCR analysis of TSH- mRNA levels of the Chinese soft-shell turtle pituitaries cultured in vitro in response to treatment of
TRH, T4, and T3 at various doses. (A) EVect of TRH, (B) eVect of T4, and (C) eVect of T3. Left panels are the representative real time PCR analysis. Right
panels are the calculated means of TSH mRNA levels relative to controls. The relative values of TSH mRNA levels were calculated from the Xuorescence
(F1) values that were parallel one another for diVerent doses of hormonal treatment at certain PCR cycles: for TRH treatment, 26–29 cycles; for T4
treatment, 29–33 cycles, and for T3 treatment, 29–33 cycles. -Actin cDNA was included as an internal control. The control values (without TRH, T4, and
T3 treatment) were considered as 100%, and TRH, T4, and T3 treated groups were calculated with respect to the controls. Values represent the means§SD
of four separate experiments (nD 4). The groups with diVerent alphabets are signiWcantly diVerent at P60.05.
80 J.-T. Chien et al. / General and Comparative Endocrinology 146 (2006) 74–82
(Fig. 2). It was demonstrated in bovine that TSH contains
only one carbohydrate chain (at asparagine residue, N24),
while TSH contains two separate carbohydrate chains
attached at diVerent asparagine residues (Liao and Pierce,
1971). A consensus sequence for N-glycosylation (N–X–S/
T) is conserved in TSH subunit of all vertebrate species at
positions 24–26 of aligned sequence (Fig. 2). As indicated in
Fig. 2, seven prolines (at positions of 5, 66, 69, 74, 79, 111,
and 114 of the aligned sequence) are present in the TSH
mature protein of the Chinese soft-shell turtle; and all these
proline residues, except the one at position of 114 (C-terminal
region), are highly conserved in the TSHs of vertebrates.
To date, no crystal structure of TSH has been
reported. However, the three-dimensional crystal structures
of gonadotropins, both chemically and structurally related
molecules of TSH, are available. According to the crystal
structure of HCG (Lapthorn et al., 1994) and human FSH
(Fox et al., 2001), proline residues are found at positions for
changing the backbone direction of the protein molecules.
Based on such crystal structures, we have constructed a
three-dimensional structural model of the Chinese softshell
turtle TSH in combination with its -subunit (amino
acid sequence of the C. soft-shell turtle -subunit, unpublished
data, J.T. Chien and J.Y.L. Yu). The structural model
of the Chinese soft-shell turtle TSH clearly revealed that all
proline residues, except the last one at position of 114 (Cterminal
region), are at the positions for changing the backbone
direction of the TSH-subunit (data was not shown).
The present study demonstrated that TSH mRNA was
expressed only in pituitary of the Chinese soft-shell turtle out
of nine diVerent tissues analyzed (Fig. 3). This Wnding is similar
to those found in Wsh (Chatterjee et al., 2001) and birds
(Gregory and Porter, 1997; Hsieh et al., 2000). Accordingly,
the expression of TSH mRNA appears to be speciWc to
pituitaries of vertebrates. On the other hand, mRNA of LH
and FSH are also expressed in oocytes of gilthead seabream,
in addition to pituitary (Wong and Zohar, 2004).
They observed that the transcript of FSH is the same in
both pituitary and ovary; while the ovarian transcript of
LH is much longer than the pituitary transcript.
A phylogenetic tree of vertebrate TSH mature proteins
is presented basing on their homology in amino acid
sequence (Fig. 5). In general, species from the same animal
classes are clustered in groups. Teleosts divert from tetrapods
in the phylogenetic tree except lungWsh and sturgeon,
which are closer to tetrapods. In tetrapods, amphibian
diverts from reptile, bird and mammal, forming a separate
branch. Reptile (Chinese soft-shell turtle) is closest to birds.
TSH stimulates the growth and function of thyroid for
synthesis of thyroid hormones. The synthesis and release of
TSH in mammals are up-regulated by hypothalamic TRH,
and are down-regulated by thyroid hormones, thus constituting
the hypothalamus–pituitary–thyroid axis. The presence
of TRH in hypothalamus has been demonstrated in
many non-mammalian vertebrates including Wsh, amphibians,
birds and reptile (Jackson and Reichlin, 1974). Preece
and Licht (1987) demonstrated that synthetic mammalian
TRH stimulated signiWcant release of immunoreactive
TSH, in a dose-related manner, from turtle pituitary
in vitro. Their Wndings provide evidence of the presence of
chelonian thyrotrope. In the present study, we have
observed that synthetic mammalian TRH stimulated TSH
mRNA levels, in a dose-related fashion, of the Chinese softshell
turtle pituitary in vitro (Fig. 4A). Our Wndings thus
support that the presence of TRH receptors in turtle thyrotropes,
and that the regulation of TSH by endogenous
hypothalamic TRH may exist in turtle as that found in
mammals (Carr et al., 1989; Croyle and Maurer, 1984) and
in duck (Hsieh et al., 2000). Suppression of pituitary TSH-
mRNA levels by thyroid hormones have been demonstrated
in teleosts (Chatterjee et al., 2001; Han et al., 2004;
Larsen et al., 1997; Pradet-Balade et al., 1998; Yoshiura
et al., 1999) and birds (Gregory and Porter, 1997; Hsieh
et al., 2000), besides mammals (Chin et al., 1993; Staton and
Leedman, 1998). No information is yet available regarding
the suppression by thyroid hormones of the transcript levels
of TSH- in reptiles. As observed in the present study,
both T4 and T3 suppressed TSH mRNA levels, in doserelated
fashion, of the Chinese soft-shell turtle pituitary
Fig. 5. A phylogenetic tree of the mature protein of the TSH subunits of
vertebrates. Phylogenetic tree of vertebrates TSH was analyzed basing
on the aligned amino acid sequences, and constructed by neighbor-joining
method. GenBank accession numbers and references of TSH sequences
analyzed in this study are indicated in Materials and methods.
J.-T. Chien et al. / General and Comparative Endocrinology 146 (2006) 74–82 81
in vitro (Figs. 4B and C). Our data thus support that a negative-
feedback is functioning in the pituitary–thyroid axis
of the Chinese soft-shell turtle. We have therefore demonstrated
that the presence of brain–pituitary–thyroid axis
including the negative-feedback of thyroid hormones in a
reptile. The Wndings may suggest that the brain–pituitary–
thyroid axis is evolutionally conserved in reptiles.
Acknowledgments
This study was supported by grants from National Science
Council and Academia Sinica, Taipei, Taiwan, ROC.
We thank Dr. Yu-San Han for his useful technical suggestions
and kind encouragement.
References
Aiyar, A., 2000. The use of CLUSTAL W and CLUSTAL X for multiple
sequence alignment. Methods Mol. Biol. 132, 221–241.
Aizawa, Y., Ishii, S., 2003. Cloning of the cDNAs encoding the beta subunit
precursor molecules of pituitary glycoprotein hormones in the
Reeves’s turtle (Geoclemys reevesii) and Japanese grass lizard (Takydromus
tachydromoides). Gen. Comp. Endocrinol. 132, 465–473.
Buckbinder, L., Brown, D.D., 1993. Expression of the Xenopus laevis prolactin
and thyrotropin genes during metamorphosis. Proc. Natl. Acad.
Sci. USA 90, 3820–3824.
Carr, F.E., Ridgway, E.C., Chin, W.W., 1985. Rapid simultaneous measurement
of rat -and thyrotropin (TSH) -subunit messenger ribonucleic
acids (mRNA) by solution hybridization: regulation of TSH
subunit mRNA by thyroid hormones. Endocrinology 117, 1272–1278.
Carr, F.E., Need, L.R., Chin, W.W., 1987. Isolation and characterization of
the rat thyrotropin subunit gene. DiVerential regulation of two transcriptional
start sites by thyroid hormone. J. Biol. Chem. 262, 981–987.
Carr, F.E., Shupnik, M.A., Burnside, J., Chin, W.W., 1989. Thyrotropinreleasing
hormone stimulates the activity of the rat thyrotropin betasubunit
gene promoter transfected into pituitary cells. Mol. Endocrinol.
3, 717–724.
Chatterjee, A., Hsieh, Y.L., Lee, G., Yu, J.Y.L., 2001. Molecular cloning of
CDNA encoding thyroid stimulating hormone subunit of bighead
carp (Aristichthys nobilis) and regulation of its gene expression. Mol.
Cell. Endocrinol. 28, 1741–1749.
Chien, J.T., Shen, S.T., Lin, Y.S., Yu, J.Y.L., 2005. Molecular cloning of the
cDNA encoding follicle-stimulating hormone beta subunit of the Chinese
soft-shell turtle Pelodiscus sinensis, and its gene expression. Gen.
Comp. Endocrinol. 141, 190–200.
Chin, W.W., Carr, F.E., Burnside, J., Darling, D.S., 1993. Thyroid hormone
regulation of thyrotropin gene expression. Rec. Prog. Horm. Res. 48,
393–414.
Croyle, M.L., Maurer, R.A., 1984. Thyroid hormone decreases thyrotropin
subunit mRNA levels in rat anterior pituitary. DNA 3, 231–236.
Fox, K.M., Dias, J.A., Van Roey, P., 2001. Three-dimensional structure of
human follicle-stimulating hormone. Mol. Endocrinol. 15, 378–389.
Gorbman, A., DickhoV, W.W., Vigna, S.R., Clark, N.B., Ralph, C.L., 1983.
The thyroid gland. In: Gorbman, A., DickhoV, W.W., Vigna, S.R.,
Clark, N.B., Ralph, C.L. (Eds.), Comparative Endocrinology. Wiley,
USA, pp. 185–275.
Gregory, C.C., Porter, T.E., 1997. Cloning and Sequence analysis of a
cDNA for subunit of chicken thyroid-stimulating hormone. Gen.
Comp. Endocrinol. 107, 182–190.
Guidon Jr., P.T., WhitWeld, G.K., Porti, D., Kourides, I.A., 1988. The
human thyrotropin -subunit gene diVers in 5 structure from murine
TSH- gene. DNA 7, 691–699.
Gurr, J.A., Catterall, J.F., Kourides, I.A., 1983. Cloning of cDNA encoding
the pre-beta subunit of mouse thyrotropin. Proc. Natl. Acad. Sci. USA
80, 2122–2126.
Han, Y.S., Liao, I.C., Tzeng, W.N., Yu, J.Y.L., 2004. Cloning of the cDNA
for thyroid stimulating hormone beta subunit and changes in activity
of the pituitary–thyroid axis during silvering of the Japanese eel,
Anguilla japonica. J. Mol. Endocrinol. 32, 179–194.
HenikoV, S., HenikoV, J.G., 1992. Amino acid substitution matrices from
protein blocks. Proc. Natl. Acad. Sci. USA 89, 10915–10919.
Herzog, W., Zeng, X., Lele, Z., Sonntag, C., Ting, J.W., Chang, C.Y., Hammerschmidt,
M., 2003. Adenohypophysis formation in the zebraWsh
and its dependence on sonic hedgehog. Dev. Biol. 254, 36–49.
Hirai, T., Takikawa, H., Kato, Y., 1989. Molecular cloning of cDNAs for
precursors of porcine pituitary glycoprotein hormone common -subunit
and of thyroid stimulating hormone -subunit. Mol. Cell. Endocrinol.
63, 209–217.
Hsieh, Y.L., Chatterjee, A., Lee, G., Yu, J.Y.L., 2000. Molecular cloning
and sequence analysis of the CDNA for thyroid-stimulating hormone
beta subunit of Muscovy duck. Gen. Comp. Endocrinol. 120, 336–344.
Ito, M., Koide, Y., Takamatsu, N., Kawauchi, H., Shiba, T., 1993. cDNA
cloning of the subunit of teleost thyrotropin. Proc. Natl. Acad. Sci.
USA 90, 6053–6055.
Jackson, I.M., Reichlin, S., 1974. Thyrotropin-releasing hormone (TRH):
distribution in hypothalamic and extrahypothalamic brain tissues
of mammalian and submammalian chordates. Endocrinology 95,
854–862.
Kato, Y., Kato, T., Tomizawa, K., Iwasawa, A., 1997. Molecular cloning of
quail thyroid-stimulating hormone (TSH) subunit. Endocr. J. 44,
837–840.
Kato, Y., Kato, T., Tomizawa, K., Kamiyoshi, M., Iwasawa, A., 1998.
Complementary DNA sequence of chicken thyroid-stimulating hormone
(TSH) subunit. Endocr. J. 45, 591–594.
Komoike, Y., Ishii, S., 2003. Cloning of cDNAs encoding the three pituitary
glycoprotein hormone subunit precursor molecules in the Japanese
toad, Bufo japonicus. Gen. Comp. Endocrinol. 132, 333–347.
Lapthorn, A.J., Harris, D.C., Littlejohn, A., Lustbader, J.W., CanWeld,
R.E., Machin, K.J., Morgan, F.J., Isaacs, N.W., 1994. Crystal structure
of human chorionic gonadotropin. Nature 369, 455–461.
Larsen, D.A., Dickey, J.T., DickhoV, W.W., 1997. QuantiWcation of salmon
- and thyrotropin (TSH) -subunit messenger RNA by an RNase
protection assay: regulation by thyroid hormones. Gen. Comp. Endocrinol.
107, 98–108.
Liao, T.H., Pierce, J.G., 1971. The primary structure of bovine thyrotropin.
II. The amino acid sequences of the reduce, S-carboxy-methyl and
chains. J. Biol. Chem. 246, 850–865.
Martin, S.A.M., Waller, W., Youngson, A.F., Smith, T., 1999. DiVerential
expression of atlantic salmon thyrotropin subunit and its cDNA
sequence. J. Fish Biol. 54, 757–766.
Maurer, R.A., Croyle, M.L., Donelson, J.E., 1984. The Sequence of a
cloned cDNA for the subunit of bovine thyrotropin predicts a protein
containing both NH2- and COOH-terminal extensions. J. Biol.
Chem. 259, 5024–5027.
Morrison, T.B., Weis, J.J., Wittwer, C.T., 1998. QuantiWcation of low copy
transcripts by continuous SYBR Green 1 monitoring during ampliWcation.
BioTechniques 24, 954–962.
Okada, R., Iwata, T., Kato, T., Kikuchi, M., Yamamoto, K., Kikuyama, S.,
2000. Cloning of bullfrog thyroid-stimulating hormone (TSH) subunit
cDNA: expression of TSH mRNA during metamorphosis. Gen.
Comp. Endocrinol. 119, 224–231.
Pierce, J.G., Parsons, T.F., 1981. Glycoprotein hormones: structure and
function. Annu. Rev. Biochem. 50, 465–495.
Pradet-Balade, B., Salmon, C., Hardy, A., Querat, B., 1998. Heterogeneity
of eel thyrotropin beta mRNAs is due to a minisatellite in the 3
untranslated region of the gene. Gene 215, 251–257.
Preece, H., Licht, P., 1987. EVects if thyrotropin-releasing hormone in vitro
on thyrotropin and prolactin release from the turtle pituitary. Gen.
Comp. Endocrinol. 67, 247–255.
Quérat, B., Sellouk, A., Salmon, C., 2000. Phylogenetic analysis of the vertebrate
glycoprotein hormone family including new sequences of sturgeon
(Acipenser baeri) beta subunits of the two gonadotropins and the
thyroid-stimulating hormone. Biol. Reprod. 63, 222–228.
82 J.-T. Chien et al. / General and Comparative Endocrinology 146 (2006) 74–82
Quérat, B., Arai, Y., Henry, A., Akama, Y., Longhurst, T.J., Joss, J.M.,
2004. Pituitary glycoprotein hormone beta subunits in the Australian
lungWsh and estimation of the relative evolution rate of these subunits
within vertebrates. Biol. Reprod. 70, 356–363.
Salmon, C., Marchelidan, J., Fontaine, Y.A., Huet, J.C., Quérat, B., 1993.
Cloning and Sequence of thyrotropin beta-subunit of a teleost Wsh, the
eel (Anguilla anguilla L). C.R. Acad. Sci. Paris 316, 749–753.
Sawin, C.T., Bacharach, P., Lance, V., 1981. Thyrotropin-releasing hormone
and thyrotropin in the control of thyroid function in the turtle,
Chrysemys picta. Gen. Comp. Endocrinol. 45, 7–11.
Sohn, Y.C., Yoshiura, Y., Suetake, H., Kobayashi, M., Aida, K., 1999. Isolation
and characterization of the goldWsh thyrotropin beta subunit
gene including the 5-Xanking region. Gen. Comp. Endocrinol. 115,
463–473.
Staton, J.M., Leedman, P.J., 1998. Posttranscriptional regulation of thyrotropin
-subunit messenger ribonucleic acid by thyroid hormone in
murine thyrotrope tumor cells: a conserved mechanism across species.
Endocrinology 139, 1093–2903.
Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving
the sensitivity of progressive multiple sequence alignment through
sequence weighting, position-speciWc gap penalties, and weight matrix
choice. Nucleic Acids Res. 22, 4673–4680.
Thompson, J.D., Plewniak, F., Thierry, J., Poch, O., 2000. DbClustal: rapid
and reliable global multiple alignments of protein sequences detected
by database searches. Nucleic Acids Res. 28, 2919–2926.
Weintraub, B.D., Wondisford, F.E., Farr, E.A., Steinfelder, H.J., Radovick,
S., Gesundheit, N., Gyves, P.W., Taylor, T., DeCherney, G.S., 1989. Pretranslational
and post-translational regulation of TSH synthesis in
normal and neoplastic thyrotrophs. Horm. Res. 32, 22–24.
Wondisford, F.E., Radovick, S., Moates, J.M., Usala, S.J., Weintraub, B.D.,
1998. Isolation and characterization of the human thyrotropin betasubunit
gene. DiVerences in gene structure and promoter function from
murine species. J. Biol. Chem. 263, 12538–12542.
Wong, T.T., Zohar, Y., 2004. Novel expression of gonadotropin subunit
genes in oocytes of the gilthead seabream (Sparus aurata). Endocrinology
145, 5210–5220.
Yoshiura, Y., Sohn, Y.C., Munakata, A., Kobayashi, M., Aida, K., 1999.
Molecular cloning of the cDNA encoding the subunit of thyrotropin
and regulation of its gene expression by thyroid hormones in the gold-
Wsh, Carassius auratus. Fish Physiol. Biochem. 21, 201–210.
Kloning Molekuler dan analisis urutan cDNA yang mengkode Hormon Tiroid hipofisis yang menstimulasi hormon-subunit β dari kura-kura Cina kulit lunak (Pelodiscus sinensis) dan peraturan dari ekspresi gen
Review
Sebuah cDNA yang mengkode hormone Tiroid-Subunit β (TSH) Adalah klone dari kelenjar hipofisis dari kura-kura Cina berkulit lunak yaitu dari species Pelodiscus sinensis dan regulasi atau pengaturan ekspresi mRNA yang diselidiki kelompok hewan melata atau Reptil. kura-kura Cina berkulit lunak TSH. (baca selengkapnya)
TUGAS KUMPUL
ada tugas pa hendro mengenai jurnal paling lambat 31 Oktober ini, cepat kumpulin hayo!! biar dapat A.
SMA TELA GARDEN
Salah satu SMA yang ada di pinggiran, yang semula dipandang sebelah mata, sekarang mempunyai kedudukan yang sama dengan SMA di kota. Mulai tahun 2007 SMA Negeri Ajibarang ditetapkan menjadi SMA Bertaraf Internasional. Sekarang memasuki tahun ke tiga, pemerintah memeberi kesempatan untuk meraih dana 6 paket.
Pada usia yang kedua puluh lima ini SMABI AJIBARANG berkerja keras untuk menghilangkan ” R “, dan semoga menjadi SMA SBI.
Semoga ini bisa tercapai. AMIN !!!!
Hello world!
Welcome to your brand new blog at Edublogs.
To get started, simply log in, edit or delete this post and check out all the other options available to you.
Also, please consider becoming an Edublogs Supporter – you can remove ads from yours and other blogs, upload up to 5GB or audio, video and every other sort of content and access great features under your ‘Plugins’ menu.
Supporters are what keeps Edublogs running and providing free blogs for education, so give it a go today
For assistance, visit our comprehensive support site, check out our getting started with Edublogs guide or stop by The Edublogs Forums to chat with other edubloggers.
You can also subscribe to our brilliant free publication, The Edublogger, which is jammed with helpful tips, ideas and more.
And finally, if you like Edublogs but want to be able to simply create, administer, control and manage hundreds of student and teacher blogs at your school or college, check out Edublogs Campus… it’s like Edublogs in a box, all for you.
Thanks again for signing up with Edublogs!
